System Information

Queue time
8s
Sfold elapsed time
3m 20s
Sfold CPU time
198.98s
Sfold resident memory usage
26332 KB
Sfold VM size
26988 KB
Mfold elapsed time
6s
Clustering elapsed time
1m 34s
Clustering CPU time
29.39s
Clustering resident memory usage
4020 KB
Clustering VM size
23568 KB


Job Information

Name
NM_017589
Folded sequence (1000 bases long)
AGGGAGACGCCTAGAAGATGGAGGCCCAGATTCTTGAGAC
GTTTCTCTTTCTGATCTAGCAGGAGGGACAAAGAGCTCCT
CCACTCCCTCATTCC..........GGAAGGCACTGCCTT
GGGCTTCCATGGCAGGAAGATGAGAAGAAATCTTCAGGGT
GATTTCTGGAGCCTGAAAAGAATAAAAAACAAAACCAAAA
Complementary sequence
No
Maximum distance between paired bases
No limit
Length of antisense oligo
20